nextflow_schema.json

{
    "$schema": "https://json-schema.org/draft/2020-12/schema",
    "$id": "https://raw.githubusercontent.com/nf-core/bactmap/master/nextflow_schema.json",
    "title": "nf-core/bactmap pipeline parameters",
    "description": "A mapping-based pipeline for bacterial whole genome sequences",
    "type": "object",
    "$defs": {
        "input_output_options": {
            "title": "Input/output options",
            "type": "object",
            "fa_icon": "fas fa-terminal",
            "description": "Define where the pipeline should find input data and save output data.",
            "required": ["input", "outdir"],
            "properties": {
                "input": {
                    "type": "string",
                    "format": "file-path",
                    "exists": true,
                    "schema": "assets/schema_input.json",
                    "mimetype": "text/csv",
                    "pattern": "^\\S+\\.csv$",
                    "description": "Path to comma-separated file containing information about the samples in the experiment.",
                    "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/bactmap/usage#samplesheet-input).",
                    "fa_icon": "fas fa-file-csv"
                },
                "outdir": {
                    "type": "string",
                    "format": "directory-path",
                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
                    "fa_icon": "fas fa-folder-open"
                },
                "email": {
                    "type": "string",
                    "description": "Email address for completion summary.",
                    "fa_icon": "fas fa-envelope",
                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
                },
                "multiqc_title": {
                    "type": "string",
                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
                    "fa_icon": "fas fa-file-signature"
                }
            }
        },
        "reference_genome_options": {
            "title": "Reference genome options",
            "type": "object",
            "fa_icon": "fas fa-dna",
            "description": "Reference genome related files and options required for the workflow.",
            "properties": {
                "genome": {
                    "type": "string",
                    "description": "Name of iGenomes reference.",
                    "fa_icon": "fas fa-book",
                    "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details."
                },
                "fasta": {
                    "type": "string",
                    "format": "file-path",
                    "exists": true,
                    "mimetype": "text/plain",
                    "pattern": "^\\S+\\.fn?a(sta)?(\\.gz)?$",
                    "description": "Path to FASTA genome file.",
                    "help_text": "This parameter is *mandatory* if `--genome` is not specified. If you don't have a BWA index available this will be generated for you automatically. Combine with `--save_reference` to save BWA index for future runs.",
                    "fa_icon": "far fa-file-code"
                },
                "igenomes_ignore": {
                    "type": "boolean",
                    "description": "Do not load the iGenomes reference config.",
                    "fa_icon": "fas fa-ban",
                    "hidden": true,
                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
                },
                "igenomes_base": {
                    "type": "string",
                    "format": "directory-path",
                    "description": "The base path to the igenomes reference files",
                    "fa_icon": "fas fa-ban",
                    "hidden": true,
                    "default": "s3://ngi-igenomes/igenomes/"
                }
            }
        },
        "institutional_config_options": {
            "title": "Institutional config options",
            "type": "object",
            "fa_icon": "fas fa-university",
            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
            "properties": {
                "custom_config_version": {
                    "type": "string",
                    "description": "Git commit id for Institutional configs.",
                    "default": "master",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "custom_config_base": {
                    "type": "string",
                    "description": "Base directory for Institutional configs.",
                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
                    "hidden": true,
                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_name": {
                    "type": "string",
                    "description": "Institutional config name.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_description": {
                    "type": "string",
                    "description": "Institutional config description.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_contact": {
                    "type": "string",
                    "description": "Institutional config contact information.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_url": {
                    "type": "string",
                    "description": "Institutional config URL link.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                }
            }
        },
        "generic_options": {
            "title": "Generic options",
            "type": "object",
            "fa_icon": "fas fa-file-import",
            "description": "Less common options for the pipeline, typically set in a config file.",
            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
            "properties": {
                "version": {
                    "type": "boolean",
                    "description": "Display version and exit.",
                    "fa_icon": "fas fa-question-circle",
                    "hidden": true
                },
                "publish_dir_mode": {
                    "type": "string",
                    "default": "copy",
                    "description": "Method used to save pipeline results to output directory.",
                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                    "fa_icon": "fas fa-copy",
                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
                    "hidden": true
                },
                "email_on_fail": {
                    "type": "string",
                    "description": "Email address for completion summary, only when pipeline fails.",
                    "fa_icon": "fas fa-exclamation-triangle",
                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
                    "hidden": true
                },
                "plaintext_email": {
                    "type": "boolean",
                    "description": "Send plain-text email instead of HTML.",
                    "fa_icon": "fas fa-remove-format",
                    "hidden": true
                },
                "max_multiqc_email_size": {
                    "type": "string",
                    "description": "File size limit when attaching MultiQC reports to summary emails.",
                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
                    "default": "25.MB",
                    "fa_icon": "fas fa-file-upload",
                    "hidden": true
                },
                "monochrome_logs": {
                    "type": "boolean",
                    "description": "Do not use coloured log outputs.",
                    "fa_icon": "fas fa-palette",
                    "hidden": true
                },
                "hook_url": {
                    "type": "string",
                    "description": "Incoming hook URL for messaging service",
                    "fa_icon": "fas fa-people-group",
                    "help_text": "Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.",
                    "hidden": true
                },
                "multiqc_config": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Custom config file to supply to MultiQC.",
                    "fa_icon": "fas fa-cog",
                    "hidden": true
                },
                "multiqc_logo": {
                    "type": "string",
                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
                    "fa_icon": "fas fa-image",
                    "hidden": true
                },
                "multiqc_methods_description": {
                    "type": "string",
                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
                    "fa_icon": "fas fa-cog"
                },
                "validate_params": {
                    "type": "boolean",
                    "description": "Boolean whether to validate parameters against the schema at runtime",
                    "default": true,
                    "fa_icon": "fas fa-check-square",
                    "hidden": true
                },
                "pipelines_testdata_base_path": {
                    "type": "string",
                    "fa_icon": "far fa-check-circle",
                    "description": "Base URL or local path to location of pipeline test dataset files",
                    "default": "https://raw.githubusercontent.com/nf-core/test-datasets/",
                    "hidden": true
                },
                "trace_report_suffix": {
                    "type": "string",
                    "fa_icon": "far calendar",
                    "description": "Suffix to add to the trace report filename. Default is the date and time in the format yyyy-MM-dd_HH-mm-ss.",
                    "hidden": true
                },
                "help": {
                    "type": ["boolean", "string"],
                    "description": "Display the help message."
                },
                "help_full": {
                    "type": "boolean",
                    "description": "Display the full detailed help message."
                },
                "show_hidden": {
                    "type": "boolean",
                    "description": "Display hidden parameters in the help message (only works when --help or --help_full are provided)."
                }
            }
        },
        "preprocessing_general_qc_options": {
            "title": "Preprocessing general QC options",
            "type": "object",
            "description": "Common options across both long and short read preprocessing QC steps",
            "default": "",
            "properties": {
                "skip_preprocessing_qc": {
                    "type": "boolean",
                    "description": "Specify to skip sequencing quality control of raw sequencing reads",
                    "fa_icon": "fas fa-forward",
                    "help_text": "Skipping running of FastQC or Falco maybe useful in cases where you are already running with preprocessed data (e.g. you are also skipping short/long read qc steps) that you already know the quality of."
                },
                "preprocessing_qc_tool": {
                    "type": "string",
                    "default": "fastqc",
                    "description": "Specify the tool used for quality control of raw sequencing reads",
                    "enum": ["fastqc", "falco"],
                    "fa_icon": "fas fa-tools",
                    "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads."
                },
                "save_preprocessed_reads": {
                    "type": "boolean",
                    "description": "Save reads from samples that went through the adapter clipping, pair-merging, and length filtering steps for both short and long reads",
                    "fa_icon": "fas fa-save",
                    "help_text": "This saves the FASTQ output from the following tools:\\n\\n- fastp\\n- AdapterRemoval\\n- Porechop\\n- Filtlong\\n- Nanoq\\n\\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
                },
                "save_analysis_ready_fastqs": {
                    "type": "boolean",
                    "description": "Save only the final reads from all read processing steps in results directory.",
                    "fa_icon": "fas fa-save",
                    "help_text": "This flag will generate the directory `results/analysis_ready_reads` that contains the reads from the last preprocessing (QC, run merging etc.) step of the pipeline run. \\n\\nThis can be useful if you wish to re-use the final cleaned-up and prepared reads - the data actually used for the actual mapping and variant calling steps of the pipeline - for other analyses or purposes to reduce redundant preprocessing between different pipelines."
                }
            }
        },
        "preprocessing_short_read_qc_options": {
            "title": "Preprocessing short-read QC options",
            "type": "object",
            "description": "Options for adapter clipping, quality trimming and pair-merging",
            "default": "",
            "properties": {
                "perform_shortread_qc": {
                    "type": "boolean",
                    "default": true,
                    "fa_icon": "fas fa-toggle-on",
                    "description": "Turns on short read quality control steps (adapter clipping, read filtering etc.)",
                    "help_text": "Turns on short read quality control steps (adapter clipping etc.)\\n\\nThis subworkflow can perform:\\n\\n- Adapter removal\\n- Read quality trimming\\n- Read pair merging\\n- Length filtering\\n\\nEither with fastp or AdapterRemoval.\\n\\nRemoving adapters (if present) is recommend to reduce false-positive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentally incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
                },
                "shortread_qc_tool": {
                    "type": "string",
                    "default": "fastp",
                    "description": "Specify which tool to use for short-read QC",
                    "fa_icon": "fas fa-tools",
                    "enum": ["fastp", "adapterremoval"]
                },
                "shortread_qc_skipadaptertrim": {
                    "type": "boolean",
                    "description": "Skip adapter trimming",
                    "fa_icon": "fas fa-forward",
                    "help_text": "Skip the removal of sequencing adapters. \\n\\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
                },
                "shortread_qc_adapter1": {
                    "type": "string",
                    "description": "Specify adapter 1 nucleotide sequence",
                    "fa_icon": "fas fa-grip-lines",
                    "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \\n\\nIf not set, the selected short-read QC tool's defaults will be used.\\n\\n> Modifies tool parameter(s):\\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
                },
                "shortread_qc_adapter2": {
                    "type": "string",
                    "description": "Specify adapter 2 nucleotide sequence",
                    "fa_icon": "fas fa-grip-lines",
                    "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \\n\\nIf not set, the selected short-read QC tool's defaults will be used.\\n\\n> Modifies tool parameter(s):\\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
                },
                "shortread_qc_adapterlist": {
                    "type": "string",
                    "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
                    "fa_icon": "fas fa-th-list",
                    "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \\n\\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \\n\\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\\n\\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\\n\\n> Modifies AdapterRemoval parameter: --adapter-list\\n> Modifies fastp parameter: --adapter_fasta"
                },
                "shortread_qc_mergepairs": {
                    "type": "boolean",
                    "description": "Turn on merging of read pairs for paired-end data",
                    "fa_icon": "fas fa-toggle-on",
                    "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data. \\n\\n> Modifies tool parameter(s):\\n> - AdapterRemoval: `--collapse`\\n> - fastp: `-m --merged_out`\\n"
                },
                "shortread_qc_includeunmerged": {
                    "type": "boolean",
                    "description": "Include unmerged reads from paired-end merging in the downstream analysis",
                    "fa_icon": "fas fa-times-circle",
                    "help_text": "Turns on the inclusion of unmerged reads in resulting FASTQ file from merging paired-end sequencing data when using `fastp` and/or `AdapterRemoval`. For `fastp` this means the unmerged read pairs are directly included in the output FASTQ file. For `AdapterRemoval`, additional output files containing unmerged reads are all concatenated into one file by the workflow.\\n\\nExcluding unmerged reads can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\\n\\n> Adds `fastp` option: `--include_unmerged`\\n"
                },
                "shortread_qc_minlength": {
                    "type": "integer",
                    "default": 50,
                    "description": "Specify the minimum length of reads to be retained",
                    "fa_icon": "fas fa-ruler-horizontal",
                    "help_text": "Specifying a minimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\\n\\n> Modifies tool parameter(s):\\n> - removed from reads `--length_required`\\n> - AdapterRemoval: `--minlength`"
                },
                "shortread_qc_dedup": {
                    "type": "boolean",
                    "description": "Perform deduplication of the input reads (fastp only)",
                    "fa_icon": "fas fa-toggle-on",
                    "help_text": "This enables the deduplication of processed reads during fastp adapter removal and/or merging. It removes identical reads that are likely artefacts from laboratory protocols (e.g. amplification), and provide no additional sequence information to the library.\\n\\nRemoving duplicates can increase runtime and increase accuracy of abundance calculations.\\n\\n> Modifies tool parameter(s):\\n> fastp: ` --dedup`\\n"
                }
            }
        },
        "preprocessing_long_read_qc_options": {
            "title": "Preprocessing long-read QC  options",
            "type": "object",
            "description": "Options for adapter clipping, quality trimming, and length filtering",
            "default": "",
            "properties": {
                "perform_longread_qc": {
                    "type": "boolean",
                    "default": true,
                    "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
                    "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\\n\\nRemoving adapters (if present) is recommended to reduce false-positive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentally incorporated adapter sequences.\\n\\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned.",
                    "fa_icon": "fas fa-toggle-on"
                },
                "longread_adapterremoval_tool": {
                    "type": "string",
                    "default": "porechop",
                    "description": "Specify which tool to use for adapter trimming.",
                    "enum": ["porechop", "porechop_abi"],
                    "help_text": "The performance of Porechop and Porechop_ABI is same in terms of removing adapter reads. However Porechop is no longer updated, Porechop_ABI receives regular updates.",
                    "fa_icon": "fas fa-hammer"
                },
                "longread_qc_skipadaptertrim": {
                    "type": "boolean",
                    "description": "Skip long-read trimming",
                    "fa_icon": "fas fa-forward",
                    "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
                },
                "longread_filter_tool": {
                    "type": "string",
                    "default": "nanoq",
                    "description": "Specify which tool to use for long reads filtering",
                    "fa_icon": "fas fa-hammer",
                    "help_text": "Nanoq is a filtering tool only for Nanopore reads. Nanoq is faster and more memory-efficient than Filtlong. Nanoq also provides a summary of input read statistics; see [benchmarking](https://github.com/esteinig/nanoq?tab=readme-ov-file#benchmarks). \\n\\nFiltlong is a good option if you want to keep a certain percentage of reads after filtering, and you can also use it for non-Nanopore long reads."
                },
                "longread_qc_skipqualityfilter": {
                    "type": "boolean",
                    "description": "Skip long-read length and quality filtering",
                    "fa_icon": "fas fa-forward",
                    "help_text": "Skip removal of quality filtering with Filtlong or Nanoq. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
                },
                "longread_qc_qualityfilter_minlength": {
                    "type": "integer",
                    "default": 1000,
                    "description": "Specify the minimum length of reads to be retained",
                    "fa_icon": "fas fa-ruler-horizontal",
                    "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\\n\\n> Modifies tool parameter(s):\\n> - Filtlong: `--min_length` or - Nanoq: `--min-len`"
                },
                "longread_qc_qualityfilter_keeppercent": {
                    "type": "integer",
                    "default": 90,
                    "description": "Specify the percent of high-quality bases to be retained",
                    "fa_icon": "fas fa-percent",
                    "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\\n\\n> Modifies tool parameter(s):\\n> - Filtlong: `--keep_percent`"
                },
                "longread_qc_qualityfilter_targetbases": {
                    "type": "integer",
                    "default": 500000000,
                    "description": "Filtlong only: specify the number of high-quality bases in the library to be retained",
                    "fa_icon": "fas fa-bullseye",
                    "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\\n\\n> Modifies tool parameter(s):\\n> - Filtlong: `--keep_percent`"
                },
                "longread_qc_qualityfilter_minquality": {
                    "type": "integer",
                    "default": 7,
                    "description": "Nanoq only: specify the minimum average read quality filter (Q)",
                    "fa_icon": "fas fa-bullseye",
                    "help_text": "Remove the reads with quality score lower than 7. \\n\\n> Modifies tool parameter(s):\\n> - Nanoq: `--min-qual`"
                }
            }
        },
        "preprocessing_run_merging_options": {
            "title": "Preprocessing run-merging options",
            "type": "object",
            "description": "Options for per-sample run-merging",
            "default": "",
            "properties": {
                "perform_runmerging": {
                    "type": "boolean",
                    "default": true,
                    "description": "Turn on run merging",
                    "fa_icon": "fas fa-toggle-on",
                    "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\\n\\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable."
                },
                "save_runmerged_reads": {
                    "type": "boolean",
                    "default": true,
                    "description": "Save reads from samples that went through the run-merging step",
                    "fa_icon": "fas fa-save",
                    "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format.\\n\\n> \\u26a0\\ufe0f Only samples that went through the run-merging step of the pipeline will be stored in the resulting directory. \\n\\nIf you wish to save the files that go to the classification/profiling steps for samples that _did not_ go through run merging, you must supply the appropriate upstream `--save_<preprocessing_step>` flag.\\n\\n"
                }
            }
        },
        "sub_sampling_options": {
            "title": "Sub-sampling options",
            "type": "object",
            "description": "Options for sub-sampling reads",
            "default": "",
            "properties": {
                "perform_subsampling": {
                    "type": "boolean",
                    "default": true,
                    "description": "Turn on sub-sampling of reads with Rasusa",
                    "fa_icon": "fas fa-toggle-on",
                    "help_text": "Subsampling sequence reads is a good idea because it reduces computational resources and processing time while still maintaining sufficient data for accurate analysis."
                },
                "subsampling_depth_cutoff": {
                    "type": "integer",
                    "default": 100,
                    "description": "Desired coverage depth when sub-sampling",
                    "fa_icon": "fas fa-ruler-vertical",
                    "help_text": "100X should more more than enough coverage to perform accurate variant calling"
                }
            }
        },
        "short_read_mapping_options": {
            "title": "Short read mapping options",
            "type": "object",
            "description": "Options for short-read mapping",
            "default": "",
            "properties": {
                "shortread_mapping_tool": {
                    "type": "string",
                    "default": "bowtie2",
                    "description": "Specify which tool to use for short-read mapping",
                    "enum": ["bowtie2", "bwa"],
                    "help_text": "By default the pipeline uses Bowtie2 but BWA mem 2 can also be used for short-read mapping ",
                    "fa_icon": "fas fa-grip-lines"
                }
            }
        },
        "long_read_mapping_options": {
            "title": "Long-read mapping options",
            "type": "object",
            "description": "Options for long-read mapping",
            "default": "",
            "properties": {
                "bam_format": {
                    "type": "boolean",
                    "default": true,
                    "description": "Specify the output format from minimap2 align",
                    "fa_icon": "fas fa-sign-out-alt",
                    "help_text": "Saves the output from minimap2 align to a bam file. \\n\\n> Modifies tool parameter(s):\\n> - minimap2: `-a`\\n>\\n. If set to false, the output of minimap2 align is saved to a paf file"
                },
                "bam_index_extension": {
                    "type": "string",
                    "default": "bai",
                    "fa_icon": "fas fa-save",
                    "description": "Specify the bam index file extension"
                },
                "cigar_paf_format": {
                    "type": "boolean",
                    "description": "Generate CIGAR",
                    "help_text": "Generate CIGAR. In PAF, the CIGAR is written to the \u2018cg\u2019 custom tag.",
                    "fa_icon": "fas fa-smoking"
                },
                "cigar_bam": {
                    "type": "boolean",
                    "fa_icon": "fas fa-smoking",
                    "description": "Write CIGAR with >65535 operators at the CG tag.",
                    "help_text": "Older tools are unable to convert alignments with >65535 CIGAR ops to BAM. This option makes minimap2 SAM compatible with older tools. Newer tools recognizes this tag and reconstruct the real CIGAR in memory.",
                    "default": true
                },
                "clair3_model": {
                    "type": "string",
                    "description": "Path to Clair3 model",
                    "fa_icon": "fas fa-check-circle"
                },
                "clair3_platform": {
                    "type": "string",
                    "default": "ont",
                    "description": "Sequencing platform",
                    "help_text": "Clair3 can align ONT, PacBio and Illumina sequence data. Here we only support ONT data",
                    "fa_icon": "fas fa-grip-lines"
                }
            }
        },
        "consensus_options": {
            "title": "Consensus options",
            "type": "object",
            "description": "Options for creating FASTA consensus files",
            "default": "",
            "properties": {
                "genomecov_threshold": {
                    "type": "integer",
                    "default": 9,
                    "description": "Specify the coverage at which low coverage regions are masked with N",
                    "fa_icon": "fas fa-bullseye"
                },
                "genomecov_scale": {
                    "type": "string",
                    "default": 1,
                    "description": "Scale the coverage by a constant factor",
                    "help_text": "Each coverage value is multiplied by this factor before being reported. Useful for normalizing coverage by, e.g., reads per million (RPM). Default is 1.0 i.e. unscaled.",
                    "fa_icon": "fas fa-balance-scale-left"
                },
                "non_GATC_threshold": {
                    "type": "number",
                    "default": 0.5,
                    "description": "Maximum non GATC bases (i.e - and N) to allow in consensus FASTA",
                    "fa_icon": "fas fa-percent"
                }
            }
        }
    },
    "allOf": [
        {
            "$ref": "#/$defs/input_output_options"
        },
        {
            "$ref": "#/$defs/reference_genome_options"
        },
        {
            "$ref": "#/$defs/institutional_config_options"
        },
        {
            "$ref": "#/$defs/generic_options"
        },
        {
            "$ref": "#/$defs/preprocessing_general_qc_options"
        },
        {
            "$ref": "#/$defs/preprocessing_short_read_qc_options"
        },
        {
            "$ref": "#/$defs/preprocessing_long_read_qc_options"
        },
        {
            "$ref": "#/$defs/preprocessing_run_merging_options"
        },
        {
            "$ref": "#/$defs/sub_sampling_options"
        },
        {
            "$ref": "#/$defs/short_read_mapping_options"
        },
        {
            "$ref": "#/$defs/long_read_mapping_options"
        },
        {
            "$ref": "#/$defs/consensus_options"
        }
    ]
}